<underline>

Underline

Definition

Used to mark text that should appear with a horizontal line beneath it for display or print

Remarks

This is normally a print consideration — not a matter for XML tagging — as underlining is frequently prohibited in online works, since it is a common “this is a link” signal.

Attribute

underline-style Appearance of the Underline

Related Elements

The Underline element is used for ordinary underlining. For underlining that involves problems with element overlap, use the milestone elements Underline Start and Underline End to mark the start and end of the sequence to be underlined.

Model Information

Content Model

<!ELEMENT  underline    (#PCDATA %emphasized-text;)*                 >

Description

Any combination of:

This element may be contained in:

<addr-line> Address Line; <aff> Affiliation; <alt-title> Alternate Title; <anonymous> Anonymous; <article-title> Article Title; <attrib> Attribution; <bold> Bold; <book-title> Book Title; <chem-struct> Chemical Structure (Display); <citation> Citation; <collab> Collaborative (Group) Author; <collection-name> Collection Name; <comment> Comment in a Citation; <conf-loc> Conference Location; <conf-name> Conference Name; <conf-sponsor> Conference Sponsor; <contract-num> Contract Number; <contract-sponsor> Contract Sponsor; <copyright-statement> Copyright Statement; <corresp> Correspondence Information; <def-head> Definition List: Definition Head; <degrees> Degree(s); <disp-formula> Formula, Display; <edition> Edition, Cited; <etal> Et Al; <ext-link> External Link; <fax> Fax Number: in an Address; <font> Font; <given-names> Given (First) Names; <gov> Government Report, Cited; <grant-num> Grant Number; <grant-sponsor> Grant Sponsor; <inline-formula> Formula, Inline; <inline-supplementary-material> Inline Supplementary Material; <institution> Institution Name: in an Address; <issue> Issue Number; <italic> Italic; <kwd> Keyword; <label> Label (Of a Figure, Reference, Etc.); <meta-name> Metadata Data Name for Custom Metadata; <meta-value> Metadata Data Value for Custom Metadata; <monospace> Monospace Text (Typewriter Text); <named-content> Named Special (Subject) Content; <on-behalf-of> On Behalf of; <overline> Overline; <p> Paragraph; <patent> Patent Number, Cited; <phone> Phone Number: in an Address; <prefix> Prefix; <preformat> Preformatted Text; <publisher-loc> Publisher’s Location; <publisher-name> Publisher’s Name; <related-article> Related Article Information; <related-object> Related Object Information; <role> Role or Function Title of Contributor; <sans-serif> Sans Serif; <sc> Small Caps; <series> Series; <sig> Signature; <sig-block> Signature Block; <source> Source; <std> Standard, Cited; <strike> Strike Through; <sub> Subscript; <subject> Subject Grouping Name; <subtitle> Subtitle; <suffix> Suffix; <sup> Superscript; <supplement> Supplement Information; <surname> Surname; <target> Target of an Internal Link; <td> Table Data Cell (XHTML table model); <term> Definition List: Term; <term-head> Definition List: Term Head; <th> Table Header Cell (XHTML table model); <title> Title; <trans-source> Translated Source; <trans-subtitle> Translated Subtitle; <trans-title> Translated Title; <underline> Underline; <uri> Uniform Resource Indicator (URI); <verse-line> Line of a Verse; <volume> Volume Number; <volume-id> Volume Identifier; <xref> X(cross) Reference

Tagged Example


...
<p>... Oligonucleotide primers for the amplification 
of TbH4 included 5&#x2032;-ATTAGGT<italic>CAT</italic>
<underline><italic>ATG</italic></underline>
<bold>CACCATCACCATCACCAT</bold>ACGCAGTCGCAGACCGTGACGG and
3&#x2032;-TATAGG<italic>AAGCTT</italic>CTAATCCTCGGTGTAGAGCGCCTCG. 
XP-1 was amplified with 5&#x2032;-CAATTA<italic>CAT</italic>
<underline><italic>ATG</italic></underline>
<bold>CATCACCATCACCATCAC</bold>AACGACGGCGAAGGAACTGTGC and 
3&#x2032;-AACCTG<italic>GAATTC</italic>GTCCATGCTCACTTCGAC,
and the 38-kDa antigen was amplified with 
5&#x2032;-CAATTA<italic>CAT</italic>
<underline><italic>ATG</italic></underline>
<bold>CATCACCATCACCATCAC</bold>TGTGGCTCGAAACCACCGAGC and 
3&#x2032;-GTACG<italic>GAATTC</italic>GTGGTCAACGAGGCTAGCTGG. 
Amplification product was digested ...</p>
...


Module

format.ent